Plates-Formes de Recherche en Neurosciences

logo amu logo cnrs

Équipe T. Brue

Accueil > Recherche > Équipe T. Brue > Protocoles > Genotyping Rosa-DiCre mice

Genotyping Rosa-DiCre mice

GENOTYPING ROSA-DICRE MICE USING PRIMERS SPECIFIC FOR THE DICRE CONSTRUCT (PLOS ONE, 2007:2(12), E1355)

PRINCIPLE

Amplification of the Cre59-SV40 polyA junction.


PCR reaction

Primers :

Target Primers Amplicon size (bp)
Rosa-DiCre
(iCre59-SV40pA)
Pr236 acctctgatgaagtcaggaagaa
Pr264 ccacaactagaatgcagtga
411 bp

Mix :

Vol for1 reactionVol. for 25 reactions
10x Taq Platinium buffer(W/O MgCl2) 2 50
dNTP 10 mM 0.4 10
Primers (10 pmol/µl) (0.4 + 0.4) (10 +10)
MgCl2 50 mM 1.2 (3mM final) 30
BSA 10 mg/ml (Biolabs) 1 25
Taq Platinium (Invitrogen, ref 10966034) 0,08 2
H2O qsp 19 µl 13,52 340

Put together at RT, distribute 19 µl in each PCR tube.
Add 1 µl target DNA prepared by the HotShot procedure (Truett et al., Biotechniques 29:52-54, 2000)
Do PCR, using 57°C for annealing, 30 secs elongation time and 35 cycles.
Run a 2% agarose gel loaded with 10 µl of the reaction.

EXPECTED RESULTS

Example with three different annealing temperatures, with with DiCre DNA (positive band) and a negative control (Cre2ERT2 DNA)

POSSIBLE ALTERNATIVES

Use the same PCR mix and conditions, but using either of the following primer pairs :

Target Primers Amplicon size (bp)
FRB-Cre60 junction #1 Pr109 ttaatggaggcccaagagtg
Pr235 gcatccacattctcctttctg
344 bp
FRB-Cre60 junction #2 Pr280 ttggggaaaggaacgtgaaagg
Pr279 aggtgctgttggatggtcttca
355 bp

II GENOTYPING ROSA-DICRE MICE USING THE GENERIC PRIMERS OF P. SORIANO, DETECTING THAT THERE IS AN INSERT (ANY) WITHIN THE ROSA26 LOCUS.

NOTES :

  1. This procedure allows the identification of homozygous vs. heterozygous vs. WT animals.
  2. It works when insertion has been done using P.Soriano’s targeting construct.
  3. The conclusion is based on the absence of the 603 bp band corresponding to the WT locus => don’t forget to have a WT or a heterozygous control (to test that PCR works OK)

Perform 2 separate PCR reactions (multiplexing is hazardous due to competition between primers), using the following primer pairs :

Target Primers Amplicon size (bp)
Wild-type Rosa26 locus Pr306 ggagcgggagaaatggatatg
Pr307 aaagtcgctctgagttgttat
603
Rosa26 locus with insert Pr307 (as above)
Pr305 gcgaagagtttgtcctcaacc
325

Use PCR mix and conditions as above, but set annealing at 60°C.

PDF - 133.1 ko
Genotyping DiCre mice
pdf document of the protocol

    Ils nous font confiance

  • logo amu
  • logo cnrs
  • logo inserm
  • logo AP-HM
  • logo F�d�ration pour la Recherche sur le Cerveau
  • logo Fondation pour la Recherche Medical en France
  • logo IBiSA
  • logo Europe programme FEDER
  • logo Agence Nationale de la Recherche
  • logo Plateforme Technologique Aix-Marseille
  • logo Vect-Horus
  • logo Neuron Experts