Accueil > Recherche > Équipe T. Brue > Protocoles > Genotyping Rosa-Cre2ERT2 mice

Genotyping Rosa-Cre2ERT2 mice

I. GENOTYPING CRE2ERT2 MICE USING PRIMERS SPECIFIC FOR THE ICRE (GENESIS, IN PRESS)

PRINCIPLE

Amplification of a portion of the iCre coding sequence.

PCR PROCEDURE

Primers :

Target Primers Amplicon size (bp)
Cre2ERT2 DNA
(iCre19-92)
Pr236 acctctgatgaagtcaggaagaa
Pr279 aggtgctgttggatggtcttca
221

Mix :

Vol for1 reactionVol. for 25 reactions
10x Taq Platinium buffer(W/O MgCl2) 2 50
dNTP 10 mM 0.4 10
Primers (10 pmol/µl) (0.4 + 0.4) (10 +10)
MgCl2 50 mM 1.2 (3mM final) 30
BSA 10 mg/ml (Biolabs) 1 25
Taq Platinium (Invitrogen, ref 10966034) 0,08 2
H2O qsp 19 µl 13,52 340

Put together at RT, distribute 19 µl in each PCR tube.
Add 1 µl target DNA prepared by the HotShot procedure (Truett et al., Biotechniques 29:52-54, 2000)
Do PCR, using 57°C for annealing, 30 secs elongation time and 35 cycles.
Run a 2% agarose gel loaded with 10 µl of the reaction.

EXPECTED RESULTS

Exemple with three different annealing temperature, with DiCre DNA (negative control) and Cre2ERT2 DNA (positive control)

POSSIBLE ALTERNATIVES

Use the same PCR mix and conditions, but using the following primer pair :

Target Primers Amplicon size (bp)
iCre sequence Pr236 acctctgatgaagtcaggaagaa
Pr235 gcatccacattctcctttctg
326 bp

II GENOTYPING ROSA-CRE2ERT2 MICE USING THE GENERIC PRIMERS OF P. SORIANO, DETECTING THAT THERE IS AN INSERT (ANY) WITHIN THE ROSA26 LOCUS.

NOTES :

  1. This procedure allows the identification of homozygous vs. heterozygous vs. WT animals.
  2. It works when insertion has been done using P.Soriano’s targeting construct.
  3. The conclusion is based on the absence of the 603 bp band corresponding to the WT locus => don’t forget to have a WT or a heterozygous control (to test that PCR works OK)

Perform 2 separate PCR reactions (multiplexing is hazardous due to competition between primers), using the following primer pairs :

Target Primers Amplicon size (bp)
Wild-type Rosa26 locus Pr306 ggagcgggagaaatggatatg
Pr307 aaagtcgctctgagttgttat
603
Rosa26 locus with insert Pr307 (as above)
Pr305 gcgaagagtttgtcctcaacc
325

Use PCR mix and conditions as above, but set annealing at 60°C.

PDF - 113.3 ko
Genotyping Cre2ERT2 mice
pdf document of this protocol

    Ils nous font confiance

  • logo amu
  • logo cnrs
  • logo inserm
  • logo AP-HM
  • logo F�d�ration pour la Recherche sur le Cerveau
  • logo Fondation pour la Recherche Medical en France
  • logo IBiSA
  • logo Europe programme FEDER
  • logo Agence Nationale de la Recherche
  • logo Plateforme Technologique Aix-Marseille
  • logo Vect-Horus
  • logo Neuron Experts