Plates-Formes de Recherche en Neurosciences

logo amu logo cnrs

Équipe T. Brue

Accueil > Recherche > Équipe T. Brue > Protocoles > Génotypages Souris Rosa-DiCre

Génotypages Souris Rosa-DiCre

Génotypage spécifique des souris Rosa-DiCre (PLoS ONE. 2007 ;2(12) :e1355)


Amplification spécifique de la jonction Cre59 SV40 polyA.

Rem : Pour la détermination d’homozygotie, voir le protocole AP005.



Marqueur Amorces Taille amplicon (bp)
ADN Rosa-DiCre
Pr236 acctctgatgaagtcaggaagaa
Pr264 ccacaactagaatgcagtga
411 bp

Mélange réactionnel : Taq Platinium Invitrogen (ref 10966034)

Volumes pour 1 réactionVolumes pour 25 réactions
Tampon Taq Platinium (sans MgCl2) 2 50
dNTP 10 mM 0,4 10
Primers à 10 pmol/µl (0,4 + 0,4) (10 +10)
MgCl2 50 mM ( vol pour 3mM final) 1,2 30
BSA 10 mg/ml (Biolabs) 1 25
Taq Platinium 0,08 2
H2O qsp 19 µl 13,52 340

Assemblage à RT, 19 µl par tube PCR de 250 µl
Ajouter 1 µl échantillon ADN HotShot (Truett et al., Biotechniques 29:52-54, 2000).
35 cycles, température d’annealing : 57°C, durée d’élongation 30"


Exemple à trois température d’annealing, sur ADN DiCre (positif) et Cre2ERT2 (négatif)


Mêmes conditions avec un des deux couples suivants :

Marqueur Amorces Taille amplicon (bp)
portion de FRB-Cre60 (une amorce sur chaque domaine) Pr109 ttaatggaggcccaagagtg
Pr235 gcatccacattctcctttctg
344 bp
idem, autre portion Pr280 ttggggaaaggaacgtgaaagg
Pr279 aggtgctgttggatggtcttca
355 bp

    Ils nous font confiance

  • logo amu
  • logo cnrs
  • logo inserm
  • logo AP-HM
  • logo F�d�ration pour la Recherche sur le Cerveau
  • logo Fondation pour la Recherche Medical en France
  • logo IBiSA
  • logo Europe programme FEDER
  • logo Agence Nationale de la Recherche
  • logo Plateforme Technologique Aix-Marseille
  • logo Vect-Horus
  • logo Neuron Experts