Accueil > Recherche > Équipe T. Brue > Protocoles > Génotypage souris Cre2ERT2

Génotypage souris Cre2ERT2

Amplification spécifique d’une portion de l’unité codante iCre (codant pour le fragment T19-L92) (donc spécifique par rapport à DiCre et aussi par rapport à d’autres souches exprimant des constructions utilisant la forme normale de la cassette Cre).

Rem : pour la détermination d’homozygotie, voir le protocole AP005

PROCEDURE PCR

Amorces :

Marqueur Amorces Taille amplicon (bp)
ADN Cre2ERT2
(iCre19-92)
Pr236 acctctgatgaagtcaggaagaa
Pr279 aggtgctgttggatggtcttca
221 bp

Mélange réactionnel :

Volumes pour 1 réactionVolumes pour 25 réactions
Tampon Taq Platinium (sans MgCl2) 2 50
dNTP 10 mM 0,4 10
Primers à 10 pmol/µl (0,4 + 0,4) (10 +10)
MgCl2 50 mM 1,2 (3mM final) 30
BSA 10 mg/ml (Biolabs) 1 25
Taq Platinium (Invitrogen, ref 10966034) 0,08 2
H2O qsp 19 µl 13,52 340

Assemblage à RT, 19 µl par tube PCR de 250 µl
Ajouter 1 µl échantillon ADN HotShot voir (BM001.1).
35 cycles, température d’annealing : 57-60°C, durée d’élongation 30" Analyse de 10 µl de la réaction sur gel agarose à 2%.

RESULTATS ATTENDUS

Exemple à trois température d’annealing, sur ADN DiCre (positif) et Cre2ERT2 (négatif)

VARIANTE POSSIBLE

Mêmes conditions avec le couple d’amorce suivant :

Marqueur Amorces Taille amplicon (bp)
portion de iCre Pr236 acctctgatgaagtcaggaagaa
Pr235 gcatccacattctcctttctg
326 bp

    Ils nous font confiance

  • logo amu
  • logo cnrs
  • logo inserm
  • logo AP-HM
  • logo F�d�ration pour la Recherche sur le Cerveau
  • logo Fondation pour la Recherche Medical en France
  • logo IBiSA
  • logo Europe programme FEDER
  • logo Agence Nationale de la Recherche
  • logo Plateforme Technologique Aix-Marseille
  • logo Vect-Horus
  • logo Neuron Experts