Plates-Formes de Recherche en Neurosciences

logo amu logo cnrs

Équipe T. Brue

Accueil > Recherche > Équipe T. Brue > Protocoles > Détermination homozygotie souris DiCre ou Cre2ERT2 ou R26R

Détermination homozygotie souris DiCre ou Cre2ERT2 ou (...)


- I - Vérification génotype = PCR avec primers spécifiques.

Voir les protocoles appropriés : exemple AP007 pour génotypage spécifique DiCre et AP008 pour génotypage Cre2ERT2

(REM : on peut aussi se passer de cette étape si on n’a pas de risques de confusion avec d’autres KI R26 en cours.)

- II - Détermination homozygotie = présence bande locus Rosa26 avec insertion et absence bande locus Rosa26 sauvage.

Deux réactions de PCR séparées (problème de compétition en multiplex) avec les couples d’amorces suivants

MarqueurAmorcesTaille amplicon (bp)
Locus Rosa26 sauvage Pr306 ggagcgggagaaatggatatg
Pr307 aaagtcgctctgagttgttat
DiCre ou Cre2ERT2 ( ou R26R) Pr307 (idem ci-dessus)
Pr305 gcgaagagtttgtcctcaacc

Conditions : Taq Platinium Invitrogen (ref 10966034)

Volumes pour 1 réaction Volumes pour 25 réactions
Tampon Taq Platinium (sans MgCl2) 2 50
dNTP 10 mM 0,4 10
Primers à 10 pmol/µl (0,4 + 0,4) (10 +10)
MgCl2 50 mM ( vol pour 3mM final) 1,2 30
BSA 10 mg/ml (Biolabs) 1 25
Taq Platinium 0,08 2
H2O qsp 19 µl 13,52 340

Important : Analyse basée sur l’absence d’amplification avec la paire WT, donc penser à ajouter un témoin WT et éventuellement un témoin hétérozygote.

Assemblage à RT, 19 µl par tube PCR de 250 µl

Ajouter 1 µl échantillon, par exemple procédure HotShot voir (BM001.1) ou 10 à 200 ng ADN génomique purifié.

35 cycles, température d’annealing : 60°C, durée d’élongation 30"

Analyse par dépôt de 10 µl sur gel agarose 2% dans 0,5xTBE.

    Ils nous font confiance

  • logo amu
  • logo cnrs
  • logo inserm
  • logo AP-HM
  • logo F�d�ration pour la Recherche sur le Cerveau
  • logo Fondation pour la Recherche Medical en France
  • logo IBiSA
  • logo Europe programme FEDER
  • logo Agence Nationale de la Recherche
  • logo Plateforme Technologique Aix-Marseille
  • logo Vect-Horus
  • logo Neuron Experts